rnaseq data sets Search Results


whole-blood rnaseq data  (Corrona LLC)
90
Corrona LLC whole-blood rnaseq data
Whole Blood Rnaseq Data, supplied by Corrona LLC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rnaseq+data+sets/10__1089_slash_nsm__2020__0007-94-13-23?v=Corrona+LLC
Average 90 stars, based on 1 article reviews
whole-blood rnaseq data - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
dnase set qiagen 79254 pgem t easy vector system promega a1360 deposited data pigeon whole genome sequencing  (Qiagen)
99
Qiagen dnase set qiagen 79254 pgem t easy vector system promega a1360 deposited data pigeon whole genome sequencing
KEY RESOURCES TABLE
Dnase Set Qiagen 79254 Pgem T Easy Vector System Promega A1360 Deposited Data Pigeon Whole Genome Sequencing, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rnaseq+data+sets/pmc08612976-587-26-28?v=Qiagen
Average 99 stars, based on 1 article reviews
dnase set qiagen 79254 pgem t easy vector system promega a1360 deposited data pigeon whole genome sequencing - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier
rnaseq data sets  (Biotechnology Information)
86
Biotechnology Information rnaseq data sets
KEY RESOURCES TABLE
Rnaseq Data Sets, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rnaseq+data+sets/bio_rxiv__64898__2026__05__07__723127-304-0-11?v=Biotechnology+Information
Average 86 stars, based on 1 article reviews
rnaseq data sets - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier
rnase h  (New England Biolabs)
99
New England Biolabs rnase h
KEY RESOURCES TABLE
Rnase H, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rnaseq+data+sets/custom%40m0297%4033503506?v=New+England+Biolabs
Average 99 stars, based on 1 article reviews
rnase h - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

Image Search Results


KEY RESOURCES TABLE

Journal: Current biology : CB

Article Title: A ROR2 coding variant is associated with craniofacial variation in domestic pigeons

doi: 10.1016/j.cub.2021.08.068

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: ​ REAGENT or RESOURCE SOURCE IDENTIFIER Critical Commercial Assays DNeasy Blood and Tissue Kit Qiagen 69504 RNAlater ThermoFisher Scientific AM7021 RNeasy Mini Kit Qiagen 74004 RNase-Free DNAse Set Qiagen 79254 pGEM-T Easy Vector System Promega A1360 Deposited Data Pigeon whole genome sequencing and pigeon embryonic craniofacial RNA-sequencing datasets NCBI SRA database PRJNA680754, PRJNA513877 Vertebrate ROR2 and invertebrate ROR homolog amino acid sequences Ensembl ( ensembl.org ) and NCBI ( ncbi.nlm.nih.gov/gene ) Experimental Models: Organisms/Strains Columba livia Shapiro Lab loft, Utah Pigeon Club, various pigeon breeders Oligonucleotides ROR2-forward GGAACCGACAGGTTCTACCA ROR2-reverse TGCTTCGTCCATCTGAAGTG WNT5A-forward CATAGTGGCTCTGGCCATTT WNT5A-reverse CCCCGACTGTTGAGTTTCAT Software and Algorithms ImageJ v1.52q https://imagej.nih.gov/ij/ Amira v6.5.0 ThermoFisher Scientific i3D Converter v3.80 IDAV Landmark Editor v3.0 UC Davis FastQC Babraham Bioinformatics Cutadapt [ 54 ] Bowtie2 [ 56 ] Stacks v2.52 [ 57 ][ 58 ] R/qtl v1.46-2 [ 67 ] msa v1.18.0 [ 61 ] geomorph v3.3.1 [ 63 ][ 64 ][ 65 ] R v3.6.3 [ 66 ] Morpho v2.8 https://github.com/zarquon42b/Morpho ggplot2 v3.3.0 [ 53 ] gggenes v0.4.0 https://github.com/wilkox/gggenes FastQForward [ 68 ] VCFLIB GPAT++ toolkit github.com/vcflib VAAST2 [ 36 ] STAR v2.5.0a [ 74 ] Subread featureCounts v1.5.1 [ 75 ] Salmon v1.5.1 [ 76 ] DESeq2 v1.12.4 [ 77 ] Open in a separate window KEY RESOURCES TABLE

Techniques: Plasmid Preparation, Sequencing, Software